Zer1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCTGCGGTCCCTGTGTGCCA, CTCCACCCATAGAGAAACAA, GCAAAGGCCCCCTAAGCCTG and GCTCTCACTTCTTGATGGAA, which resulted in a 1269 bp deletion beginning at Chromosome 2 position 30,108,607 bp and ending after 30,108,607 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001234186, ENSMUSE00001310927, ENSMUSE00000285938 (exons 6-8) and 832 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 320 and early truncation 7 amino acids later. (J:188991)