This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTAGTCCAGGAGCTACTACA, GGGATGCCTTTACCCCACCG, CGTGGGTCTTTCCTTTTCCG and CTGCCTGGAAGGAGACCGGA, which resulted in a 1006 bp deletion beginning at Chromosome 4 position 43,423,415 bp and ending after 43,424,420 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001313395, ENSMUSE00001264890, ENSMUSE00001301458 (exons 6,7,8) and 648 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 998 and early truncation 49 amino acids later. (J:188991)