This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGAAGGCAGGTTATAGACCA, GCTTGAGGTAGACATGCCAG, TTTTGTACAAGAGCCCCACT and AGATCGGCAAAACTTAAATG, which resulted in a 641 bp deletion beginning at Chromosome 6 position 121,040,118 bp and ending after 121,040,758 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001050613 (exon 3) and 443 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 4 bp insertion (GATC) and a 5 bp deletion (TTTAA) 59 bp before the start of the exon deletion, that will not alter the results of the deletion, which is predicted to cause a change of amino acid sequence after residue 88 and early truncation 6 amino acids later. (J:188991)