Utp20^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCTGATACAGTAAACTAACA, GCAGCAGGTCTACCAGCAGC, GAGAAAGTGCAATGTACACC and GCATCTTAGGACAAGGATAA, which resulted in a 691 bp deletion beginning at Chromosome 10 position 88,821,559 bp and ending after 88,822,249 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000608557 and ENSMUSE00000608556 (exons 3 and 4) and 491 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 11 amino acids later. (J:188991)