Sec62^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGCATTTTCATTACCGTTGA, CTAATTGTTATCCTTCACCA, GTTGATTATTCAGAGATTGA and TATTTACCAGAGCTACTGAA, which resulted in a 537 bp deletion beginning at Chromosome 3 position 30,800,839 bp and ending after 30,801,375 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000172459 (exon 3) and 431 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 2 amino acids later. (J:188991)