This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TTGGTAGAAAATAAACTACC, AAACATTTCACATACTAGAG, GTATGTTACTTTACAAATCT and ACATTTCTAAGTCAGGATGT, which resulted in a 293 bp deletion beginning at Chromosome 3 position 69,094,589 bp and ending after 69,094,881 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000567751 (exon 7) and 207 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 127 and early truncation 18 amino acids later. (J:188991)