Appbp2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGGTGGTGGATATTTTGG and ACAACTCTCGCTGCCGGGCG, which resulted in a 237 bp deletion beginning at Chromosome 11 position 85,216,273 bp and ending after 85,216,509 bp (GRCm38/mm10). This mutation deletes all but the first 15 bp of ENSMUSE00000105717 (exon 2) and 163 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 15 amino acids later due to read through into the intron between exons 2 and 3. (J:188991)