Thsd4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACCTTGATTCTGCAGAAT and ACTGGACCCATGTGGACACA, which resulted in a 516 bp deletion beginning at Chromosome 9 position 60,428,091 bp and ending after 60,428,606 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000636311 (exon 4) and 154 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 52 amino acids later. (J:188991)