This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences AACTCAAGAGTAATAAACAA and TTAATTGTTCTAATTGTATT, which resulted in a 1640 bp deletion beginning at Chromosome 16 position 20,654,355 bp and ending after 20,655,994 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001269400, ENSMUSE00001242405, ENSMUSE00001235947, ENSMUSE00001282580, ENSMUSE00001296185 (exons 4-8) and 928 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 13 amino acids later. (J:188991)