Safb2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGGCCCAGCGTCAAGCAC and GTTGCAGAGTCACTGTCAGC, which resulted in a 317 bp deletion beginning at Chromosome 17 position 56,582,960 bp and ending after 56,583,276 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220258 (exon 2) and 229 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 25 amino acids later. (J:188991)