This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GAGGGAAATGAGCTCAGCAG, AATCTCTTCAGTCATCCCGA, GTTCTCCATCTGCCACCATC and TTACATCCTAAAAGAGAGAA, which resulted in a 460 bp deletion beginning at Chromosome 3 position 90,413,231 bp and ending after 90,413,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000457114 (exon 6) and 393 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp deletion (AG) 50 bp before the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 172 and early truncation 3 amino acids later. (J:188991)