Rnf214^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATCCAAAGAGGTTACACAT, CTTTCTACCCAACAATTTGT, CTACTACTAAAATGGAATTG and GGAGAAGGCCTATAGCATCT, which resulted in a 992 bp deletion beginning at Chromosome 9 position 45,899,524 bp and ending after 45,900,515 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001272251 (exon 3) and 481 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 35 and early truncation 10 amino acids later. (J:188991)