Taok3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTTGGTGTGGTTAACTTG, AGTGTCCGTGCCTGTACATG, which resulted in a 279 bp deletion followed by a 3 bp (GTG) endogenous retention and an additional 42 bp deletion beginning at Chromosome 5 position 117,203,195 bp and ending after 117,203,518 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001280462 (exon 6) and 275 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and early truncation 29 amino acids later. (J:188991)