D5Ertd579e^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCTTGACAAGGACAGAAAA, ATTATTTTATGTCACTACGG, ACACTGAGAAGGACCCTGTA and GAATCCCAGAGTTTAAAAAC, which resulted in a 242 bp deletion beginning at Chromosome 5 position 36,619,631 bp and ending after 36,619,872 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001300199 (exon 4) and 175 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a (CCAAG) 5 bp insertion and a 17 bp deletion (TTTTCTGTCCTTGTCAA) 220 bp after the 242 bp deletion that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 122 and early truncation 7 amino acids later. (J:188991)