This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCATGGCTCAGAACCCAT, CTATCCTTACCCCTTATCCA, AGTGCATGACCCTTACGGGT and AGAATGTTTGGACCATACCA, which resulted in a 920 bp deletion beginning at Chromosome 17 position 24,219,468 bp and ending after 24,220,387 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001233864 and ENSMUSE00001227889 (exons 3 and 4) and 458 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50, a deletion of 154 amino acids and then remain in frame until normal termination. (J:188991)