This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCCACGAAGAAATGCCA, CTGATTCCCATCTTAAGAAG, TGTGACAGTCCATCTGGGGA and GCTACAATTCATTACAAAGA, which resulted in a 521 bp deletion beginning at Chromosome 4 position 99,961,333 bp and ending after 99,961,853 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001083174 (exon 2) and 358 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 26 amino acids later. (J:188991)