Dnajc13^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGCTTTCTAGACTCTCGA, GTTCCCACTAAAATAAGTGG, CTGACTTCAGCAGGGAAGAT and ATAGTTCCCACTAAAATAAG, which resulted in a 495 bp deletion beginning at Chromosome 9 position 104,238,263 bp and ending after 104,238,757 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000395222 (exon 3) and 419 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 35 amino acids later. (J:188991)