This allele from project TCPR0590 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GCCCTGCATAAGAACATGGG and GTCAGCATGTATTTTGGGTC targeting the 5' side and TTTGAGTTAGAGTGCAGTAT and ATGCCTGTGCCTGATCTGAC targeting the 3' side of exons ENSMUSE00000648121 (exon 6), ENSMUSE00000648120 (exon 7), ENSMUSE00000648119 (exon 8), ENSMUSE00000648118 (exon 9), and ENSMUSE00000648117 (exon 10). This resulted in a 2,899-bp deletion of Chr11 from 99014059 to 99016957_ins.GATA and a 9-bp deletion of Chr11 from 99013968 to 99013976 (GRCm38). (J:237616)