This allele from project TCPR0692 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTAGCACCACCACATCTGAG and GGCCGACCCCATATGCTAAA targeting the 5' side and CAGATCGCTTCCTGGAACCT and GTGAGCGTCCTTGACAGGAT targeting the 3' side of a set of critical exons. This resulted in a 2104-bp deletion of Chr17 from 34802035 to 34804138 (GRCm38). (J:237616)