This allele from project TCPR0434 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ACTACCCTGGTTGGACTGGC and GCAATCATCCCCTATATCTC targeting the 5' side and CCCTCTTAAGAACTCTTTTC and ATTGACAGTGCCAAGAAAGT targeting the 3' side of exon ENSMUSE00000531437 (exon 2) resulting in a 772-bp deletion of Chr7 from 48020898 to 48021669 (GRCm38). (J:237616)