This allele from project TCPR0929 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGAGGATCTAAATATGACCC targeting the 5' side and GCTACATCAAGTTTAGAAGT targeting the 3' side of a critical region. This resulted in a 218-bp deletion from Chr17:6070720 to 6070937 (GRCm38). (J:237616)