This allele from project TCPR1036 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATAGGGGTCTGGTGATCTA and GAGGGTTCCCCACTGCCAAT targeting the 5' side and CGTGTCAGGACATCCACCAC and GCGGAACTTGCTCATGGAAC targeting the 3' side of a critical region. This resulted in a 3716-bp deletion from Chr7:127608671 to 127612386; (predicted effect on protein p.P84X.) (GRCm38). (J:237616)