Mrgprb2^em1(IMPC)Tcp

This allele from project TCPR0501 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AGGTGCTTAGATTCTTGATT and CATTTAGTCCCATCCCAACC targeting the 5' side and TTAGGCACCGAAGGTTCAGG and GAGTCTTCCGCCTGAACCTT targeting the 3' side of exon ENSMUSE00000388025 (exon 2). This resulted in an 890-bp deletion of Chr7 from 48552076 to 48552965 (GRCm38). (J:237616)