This allele from project TCPR0925 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGCTAAACCATGAGCTGCTC and CCCGAGACCGCAGGAAACAT targeting the 5' side and GGTTTGTCCAGCGGCCGTCC and TGTCACCTGACAGCGAGCCC targeting the 3' side of a critical region. This resulted in a 431-bp deletion Chr8:124375935 to 124376365 (GRCm38). (J:237616)