This allele from project TCPR0782 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCGGCCGCGTGGGCCTCAAT and ATCGGGTCTGGCACCGCTCC targeting the 5' side and TTTCCCTCTCGCAACTGCAC and GAGCCAACGGTCATCAGAGA targeting the 3' side of exon ENSMUSE00000593055 resulting in a 1,548-bp deletion of Chr7 from 62418469 to 62420016 (GRCm38). (J:237616)