This allele from project TCPR0641 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ATCACTGGTATAGGCTGGAT and ATGATCGGGTGCTTCAATCA targeting the 5' side and GGCAGATCGAGAGTCCTCAC and AAAGCGCGTGGAACGAGAAC targeting the 3' side of a critical region. This resulted in a 4,030-bp deletion of ChrX from 104084031 to 104088060. (GRCm38). (J:237616)