This allele from project TCPR0758 was generated at The Centre for Phenogenomics by electroporating Cas9 ribnucleoprotein complexes with four guide RNAs having spacer sequences of CACTACTACCCAGGTAAGCG and GCTAACCTGGAGATTTCACC targeting the 5' side and CTGTTGGGGAAATACCCGGC and GATACGTCAGGTAGAACTAG targeting the 3' side of exons ENSMUSE00000438166, ENSMUSE00000374366 and ENSMUSE00000304458 resulting in a 1125-bp deletion of Chr12 from 113157114 to 113158238 (GRCm38). (J:237616)