This allele from project TCPR0903 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTATCACTCTACCTTCCCGA and TACCTATTGAAGGAGCGAAT targeting the 5' side and TACAGGAGTTGTGCCGACGA and CCCCGTTACATGAGTAATGA targeting the 3' side of exon ENSMUSE00000751233 and ENSMUSE00000257623. This resulted in a 904-bp deletion of Chr9 from 57715453 to 57716356 with a 4-bp insertion AAGG (GRCm38). (J:237616)