This allele from project TCPR1049 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCCACCAGCTCTCCGGATTC and ATGCAGTTACGGAGCCTGAC targeting the 5' side and GCGCGCAGAGCTCTACCGCG and AGCGCCGCAGTTCTTCCTGC targeting the 3' side of a critical exon(s). This resulted in a 759-bp del Chr19: 6855420 to 6856178_insA (GRCm38). (J:237616)