This allele from project TCPR0924 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGGGCTATTTTTACCAGCTC and CGGCCAGCAAGAGCTCTAGC targeting the 5' side and TATTGGGTGCAAGTCTCGAG and GGGGCATTCCCATTAACCAC targeting the 3' side of a critical exon. This resulted in a 573-bp deletion Chr11:86945593 to 86946165 (GRCm38). (J:237616)