This allele from project TCPR0452 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CTATCTTACGTGACAGAATG and TAGCATCGCCTCTAACCGCA targeting the 5' side and GCCCCTCCCAGTTGAAGTCC and CCGAAGTCATAGTAGCTACC targeting the 3' side of exon ENSMUSE00000343496 (exon 11). This resulted in a 849 bp deletion of Chr7 from 30261130 to 30261978. (GRCm38). (J:237616)