This allele from project TCPR901 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACGGCTCATGGTGGTGCTTA and TCGGGTCTCGTGCCACGTGG targeting the 5' side and AGCAGGAGCCTGAACCGGTA and TACCGAGAGTAGTCCTCACA targeting the 3' side of a critical region resulting in a 3,234-bp deletion Chr11:120686285 to 120689518_insInv(Chr11:120689344 to 120689502) (GRCm38). (J:237616)