This allele from project TCPR0733 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACAGACGCTGCCAAGGGAAC and GATCCTGCGACAACAATGAG targeting the 5' side and TTCACGCTGTGGGTTCGGGT and AAATCATACCTTAGGAGGGT targeting the 3' side resulting in a 3101-bp deletion of Chr10 from 80230041 to 80233141 (GRCm38). (J:237616)