This allele from project TCPR0848 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGAAGGTTCTGAAGTGATCA and TCACTACTAATGCCGAGCGG targeting the 5' side and ACTTCGGCTCTACACGGAAA and CGAAACGATCTGTACTGACC targeting the 3' side of a critical region. This resulted in a 927-bp deletion Chr13: 41007478 to 41008404 (GRCm38). (J:237616)