This allele from project TCPR0950 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGCATGCAGCTTATGAGCTA and CATCTATCTATTACTAGCAG targeting the 5' side and GCCATGGCATACTACATCAA and TCGAGGTCACACACTCCTAC targeting the 3' side of a critical region. The resulted in a 1098-bp deletion from Chr5:33921362 to 33922459 (GRCm38). (J:237616)