This allele from project TCPR0971 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTGTCAGGTATTAGTATTGT targeting the 5' side and AGTGTAGCAACCTGCAAGCC and GTCTGTACGGTATGATAGCC targeting the 3' side of a critical region. This resulted in a 324-bp deletion Chr8:41267158 to 41267481 (GRCm38). (J:237616)