Cct5^em1(IMPC)Tcp

This allele from project TCPR0902 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GACCACAGTCAAGGTCCAAC and AATAGGGCTGGATGTAATCC targeting the 5' side and GGCCACAGTACACTACTGAT and AGGTGATCCAATAACCTAAA targeting the 3' side of a critical exon(s). This resulted in a 395-bp deletion of Chr15 from 31595629 to 31596023 and and indel at Chr15:31595496_insTTG (GRCm38). (J:237616)