This allele from project TCPR0787 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs having spacer sequences of GCTATGAGTGTACCCTTGCT and AAAATTGGCATAGCCCCCAT targeting the 5' side and TCAAGCATACCTTTCAAGGT and GGTTTAATAGATCAAATGGA targeting the 3' side of exons ENSMUSE00001230146, ENSMUSE00001252442, and ENSMUSE00001304574 (exons 3-5). This resulted in a 1,493-bp deletion of Chr19 from 12777780 to 12779272 (GRCm38). (J:237616)