This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences TGCGAAACACTTCCCTACTCTGG, GCCATATAGATTGGTGGCAGTGG, GCTAGATGCCGGTGTAGGTTTGG, CCACGGCATGAAAGCTAGATGCC, which resulted in a Exon Deletion. Sequencing of F0 animals revealed an individual with a 716 nt deletion encompassing ENSMUSE00000122772 of Spata13 resulting in a frameshift and premature stop codon in the following exon. (J:237616, J:274791)