Mice harboring point mutations in one of the two glucocorticoid response elements (GREs) in the Il7r enhancer (upstream of the gene) were generated. The sequence mutated is in the first element (GRE1) as follows: GRE1 wild-type, CTTTGTTCTTTTACATCTTCA; GRE1m, CTTcacTgcTTTgagTgcTCA. A targeting construct containing the mutations and a loxP site flanked neomycin selection cassette was used to create mutant ES cells via homologous recombination. The neo cassette was removed through subsequent cre-mediated recombination. (J:260412)