Acap2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAGGTTCTGAAGTGAGGCG, GCTAACCGCTCATCACGGAA, AGTGAGAACACAGATACAAA and TTATTGTCACGTTTACATAA, which resulted in a 239 bp deletion beginning at Chromosome 16 position 31,160,270 bp and ending after 31,160,508 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000128130 (exon 2) and 181 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 2 amino acids later. (J:188991)