Cep350^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTGAGTTGATAGGTAGGG, AGACACTGCAGTAGGGTCTC, GGATACTCAGTTCACACCGA and GCATTGGATAAGGGCTGAAG, which resulted in a 392 bp deletion beginning at Chromosome 1 position 155,960,980 bp and ending after 155,961,371 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000537328 (exon 3) and 348 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a small indel, a 1 bp (T) insertion and 4 bp (GGTA) deletion, 88 bp after the 392 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 24 and early truncation 4 amino acids later. (J:188991)