This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GTGGTATAAGAAATATAACT and GCCTTCTCTATTATCCTCCT, which resulted in a 648 bp deletion beginning at Chromosome 7 position 131,325,916 bp for 46 bp to 131,325,962 bp retaining 3 bp, TTA, and then an additional 602 bp deletion ending after 131,326,566 (GRCm38/mm10). This mutation deletes ENSMUSE00001326894 (exon 4) and 267 bp of flanking intronic sequence including the splice acceptor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 10 amino acids later. (J:188991)