The conditional-ready parent allele was generated at The Jackson Laboratory by pronuclear injection of Cas9 RNA and 2 guide sequences TTTCTGACCCACTGTTATCG and GATGAAGAGAGGATACATCC, with plasmid donor Htr3a_Floxed exon 5, which contains exon 5 flanked by loxP and HindIII sites and 1kb homology arms. This produced a 2,513 bp knock-in beginning at Chromosome 9 negative strand position 48,905,948 bp GCTTCTGGTCACAGATGAG, and ending after AGTGGAGGGCTAGGAAAGGC at 48,903,515 bp (GRCm38/mm10). This knock-in added a single bp change C to G 5 bp before the addition of a 34 bp loxP site followed by a 6 bp HindIII restriction site (AAGCTT) to the 5-prime side of exon 5, 195 bp upstream (5-prime) of the exon, and a second single base pair C to G change 55 bp downstream (3-prime) of the exon, followed 5 bp later by another HindIII restriction site (AAGCTT) and a 34 bp loxP site. Subsequent Cre excision deleted all 170 bp of exon 5 as well as 240 bp of flanking intronic sequence for a total deletion of 410 bp. This deletion is predicted to cause a change of amino acid sequence after residue 130 and early truncation 16 amino acids later. (J:188991)