This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGATGGGAACAGGTAAGCG, GCTTGGGCTTGTTTACCTGA, TTGGAAGCTGTAATAAACAG and ACATGTCAATTACTACTGCT, which resulted in a 289 bp deletion beginning at Chromosome 4 position 58,876,921 bp and ending after 58,877,209 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000527161 (exon 4) and 170 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp insertion (GAAT) and a 6 bp deletion (TAAACA)47 bp before the 289 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 90 and early truncation 16 amino acids later. (J:188991)