This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTAGTACTTTATAGATGGA, CCCTCCATCTATAAAGTACT, TCATAAGTAGGAAATCTGTC and CTTTCATATGTGCAAAATAT, which resulted in a 773 bp deletion beginning at Chromosome 15 position 45,112,795 bp and ending after 45,113,567 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000125700 (exon 2) and 243 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 157 and early truncation 12 amino acids later. (J:188991)