This allele was generated at The Jackson Laboratory by electroporation of Cas9 protein and 4 guide sequences TGGTCAACAGCGTCGCCTAA, ATTATCCTTCCCAATTCACA, GTGTGGCTAGCAAATCTTGC and TTTAGTGGAAGACGTGTCGT, which resulted in a 3032 bp deletion beginning at Chromosome 18 position 37,680,029 bp and ending after 37,683,060 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001339721 (exon 1) and 425 bp of flanking intronic sequence including the Kozak sequence and splice donor and is predicted to cause a null allele. (J:188991)