Dguok^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTTGGGAAACCACAAAGAC, AGACATGCACGCAGTCTAAT, GCAGCCAGTAACTTCTGCCA and TGCTTCCCAAATCCAGGTGA, which resulted in a 377 bp deletion retention of 3 bp (CAA)of endogenous sequence and further deletion of 26 bp, beginning at Chromosome 6 negative strand position 83,496,866 bp and ending after 83,496,461 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273030 (exon 2) and 290 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 47 and early truncation 55 amino acids later. (J:188991)