Stard9^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCAGGAGAGACTAACAAAA, GGTGCTTTGTGGTAAGATGA, GCTAGTCCGGGGCAACCCAA and TTTCACGTCAGGGTCAGCAG, which resulted in a 453 bp deletion beginning at Chromosome 2 positive strand position 120,666,304 bp and ending after 120,666,756 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000167832 and ENSMUSE00000167830 (exons 5 and 6) and 358 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 17 bp deletion (GTCCGTCCCTTTTGTTA) 96 bp before the 453 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 117 and early truncation 19 amino acids later. (J:188991)