Uck2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACATCAATCAGAAAGGCCAG, TCCTGTCCACACATACCATA, AAAACGGTAAGACAGTGCCG and TATATTACTAGAGCTCAGGG, which resulted in a 709 bp deletion beginning at Chromosome 1 negative strand position 167,237,777 bp and ending after 167,237,069 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000160510 (exon 2) and 549 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 33 and early truncation 51 amino acids later. (J:188991)